User Story 1 – Identifying virus resistant PGRs using Pretzel¶
Overview of Key Steps To Visualise Results in Pretzel
-
Project genetic map QTL into Cameor v1 genome assembly
-
Integrate genes and KASP markers
-
Identify sbm-1 gene with BLAST search
-
Examine WGS genotypes around the sbm-1 gene to identify haplotype shared by resistant accessions
-
Identify Multispecies Pulse 30K SNP array marker(s) that tag the haplotype
-
Examine PGRs from the AGG using the identified marker(s) to identify PGRs likely carrying the PSbMV resistance allele
Login¶
Log in with the provided details on https://agg.plantinformatics.io/login:
Email Address (username)
UserStory1@AGG
Password
UserStory1
Note
Please use the provided login account so you have access to all the relevant data
Video tutorial¶
Step by step with screenshots¶
Load genetic map and QTL¶
Navigate to the 'Explorer' tab and scroll down to the Datasets box find
Field pea PSbMV QTL mapped in Kaspa x Yarrum
and select
Ps VI
Load SNP marker locations in the genome assembly¶
In the same 'Explorer' tab and Datasets box find
Field pea genetic map SNP markers anchored to genome assembly (Cameor v1)
and select
chr1LG6
Invert the orientation of the axis¶
In the centre view click on the title of the axis at the top
Kaspa x Yarrum : Ps IV
This will bring up the axis title menu on screen. Click the middle button to invert the orientation of the axis
To close this box press the top right "x" button
(Optional) Display the position and name of QTL¶
On the left axis locate the 3 boxes and click on one of them
An arrow should appear on left of the axis and click the arrow to bring the up name
(Optional) Resize the display¶
Navigate to the 'View' tab, scroll down till you find the slider titled 'Outside Axis Margin' and reduce this value to increase the distance between axes in the visualisation
Outside Axis Margin
Displaying features within the axis¶
In the centre view click on the title of the right axis at the top to bring up the same menu from earlier. This time, click on the right most button to display features. Then close it using the same "x" button in the top right hand corner.
Load KASP marker positions in the genome assembly¶
In the 'Explorer' tab and Datasets box find
Field pea KASP markers for PSbMV (Swisher 2020)
and select
chr1LG6
Locate sbm-1 gene in genome assembly using BLAST search¶
Navigate to 'Search' tab, scroll down to DNA Sequence Blast Search and input the following text into the search box
>AY423375.2
GGAGAAAGAAACCGAGAGAGAGCAAAAATGGTTGTAGAAGAAACCCCCAAATCCATCATCACCGACGATCAAATCACAACAAACCCTAATCGCGTTATCGAAGACGACAACAATCTTGAAGAAGGAGAGATCCTCGATGAAGACGATTCCTCCGCCACTTCCAAACCCGTCGTCCACCAACCTCACCTCCTCGAGAATTCTTGGACTTTCTGGTTTGATACCCCCGCAGCAAAATCCAAACAAGCCGCTTGGGGTAGCTCAATGCGACCCATCTACACTTTCTCCACTGTTGAAGAGTTTTGGAGCATTTACAATAACATTCATCATCCTGGTAAGTTGGCTGTGGGAGCAGATTTCTATTGTTTCAAGCATAAAATTGAACCTAAATGGGAGGATCCCATTTGTGCTAATGGTGGGAAATGGACTGCGAACTATCCGAAGGGAAAATCTGATACCAGTTGGTTATACACGTTGTTGGCAATGATTGGAGAACAATTTGATCATGGAGATGAAATTTGCGGAGCGGTTGTGAATGTAAGGGGTAGGGCTGAGAAGATTTCTATTTGGACTAAGAATGCTTCAAATGAAGCTGCTCAGGTGAGCATTGGAAAACAGTGGAAGGAGTTTCTTGATTATAATGAGACCATGGGCTTTATATTTCATGATGATGCAAGGAAACTCGACAGAAATGCTAAAAACAAATATGTTGTGTGAACTGTATTGCGTTCTTACATGGTAGCAAACTAGCAATTGCATGAGATGCCTCTCCGATATTCAACATGTTGCTTAATGCTTTCTAAGCCTTTTAAATCTCGTATTGAGTAGTATTTCCAGATTTGTGTGCGGATAATCTTTTGACTGTAGACGATGTTTCATCAATAATAGAGTGATTTAGTCAAAAAAAAAA
Scroll down even further and select
Field pea reference genome (Cameor v1)
This will then make the search button clickable and then press the search button.
Scroll up and a new tab will appear in the DNA Sequence Blast Search titled "Blast output". Click the tab to display the results (they may take some time to arrive). Clicking the button at the top of the table will maximise the table.
(optional) Inspect BLAST results¶
Full details of the BLAST results are shown in the table. Control the hits shown in the view by checking/unchecking the view column.
Zoom to region around sbm-1 gene¶
Use Pretzel's zoom functions Zooming in and out of datasets to refine the view. Zoom in to the region around the sbm-1 gene.
Load genome assembly gene annotation¶
In the Explorer tab, find
Field pea reference genome annotation (Cameor v1)
and select
chr1LG6
Load whole genome sequence (WGS) based SNP data from resistant and susceptible accessions¶
In the Explorer tab, find
Field pea WGS genotype data for resistant and susceptible accessions
and select
chr1LG6
Select (brush) region around gene¶
If needed, refine the zoomed region to include the immediate area around the sbm-1 gene.
Click and drag on the right-hand axis to select the region around the gene.
Switch to Genotypes tab in right panel¶
In the right panel, click the Genotypes tab. Click and drag the resize bar to expand the width of the right panel.
Load genotype data for resistant and susceptible accessions¶
Click the icon at the right of the Genotypes to open the Genotypes dialog menu. While holding Shift, click on the first sample in the list, scroll down to the bottom and click on the last sample, to select all samples. Then click VCF Lookup.
Sort accessions based on haplotype around the KASP marker position¶
Click on the ALT column in line with the KASP marker (the dark purple square in the 3rd column of the table). The cell should change to a green colour when it has been clicked. This will order the samples based on their allele at this position.
Load Multispecies Pulse 30K SNP array AGG field pea PGR genotype dataset¶
In the Explorer tab, find
Field pea AGG 30K genotype data sample
and select
chr1LG6
Identify SNP on Pulse 30K array that tags identified haplotype¶
In the Genotypes tab in the right panel, Pulse 30K positions are now indicated by orange squares in the second column of the table.
Remove WGS data from the view¶
Click on the axis title at the top of the right-hand axis and click the X to the left of the WGS dataset to remove it from the view.
Load genotypes from AGG field pea PGR¶
Click the icon at the right of the Genotypes to open the Genotypes dialog menu. While holding Shift, click on the first sample in the list, scroll down to the bottom and click on the last sample, to select all samples. Then click VCF Lookup.
Sort accessions based on allele at the identified SNP¶
Click on the ALT column in line with the Pulse 30K marker identified in the previous steps. The cell should change to a green colour when it has been clicked. This will order the samples based on their allele at this position.
